Cathepsin b complexed with dipeptidyl nitrile inhibitor Deposition Author(s): Bohacek, R.S. , Capparelli, M.P. , Clark, K.L. , Coppa, D.E. , Cowen, S.D. , Doughty, J.R. , Du, Z. , Fang, Z. , Farley, D.L. , Fitt, J.J. , Goldberg, R.L. , Goldstein, R. , Greenspan, P.D. , Knap, A.K. , Macchia, W. , Mcquire, L.W. , Tommasi, R.A. , Van Duzer, J.H. , Wigg, A.M. , Zhou, H. , Zhu, L.
Date: 2001-09-25 Method: X-RAY DIFFRACTION Resolution: 1.9 Å Organism(s): Sordaria Macrospora (Strain Atcc Mya-333 / Dsm 997 / K(L3346) / K-Hell) Sequences Data: 1GMY_A , 1GMY_B , 1GMY_C
Structure of tar rna complexed with a tat-tar interaction nanomolar inhibitor that was identified by computational screening Deposition Author(s): Du, Z. , James, T.L. , Lind, K.E.
Date: 2002-05-28 Method: SOLUTION NMR Resolution: N.A. Organism(s): Anoxybacillus Sp. Lm18-11 Sequences Data: 1LVJ_A
Nmr structure of the r(ggaggacaucccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with aucccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7W_A
Nmr structure of the r(ggaggacauuccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with auuccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7Z_A
Extending the family of uncg-like tetraloop motifs: nmr structure of a cacg tetraloop from coxsackievirus b3 Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Yu, J.
Date: 2003-12-02 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1ROQ_A
Stem-loop d of the cloverleaf domain of enteroviral 5'utr rna Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2004-07-06 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1TXS_A
Crystal structure of kh1 domain of human poly(c)-binding protein-2 with c-rich strand of human telomeric dna Deposition Author(s): Du, Z. , James, T.L. , Lee, J.K. , Li, S. , Stroud, R.M. , Tjhen, R.J.
Date: 2005-09-06 Method: X-RAY DIFFRACTION Resolution: 1.7 Å Organism(s): Salmonella Enterica , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) Sequences Data: 2AXY_E , 2AXY_F , 2AXY_G , 2AXY_H , 2AXY_A , 2AXY_B , 2AXY_C , 2AXY_D
Linear dimer of stemloop sl1 from hiv-1 Deposition Author(s): Du, Z. , James, T.L. , Mujeeb, A. , Parslow, T.G. , Tonelli, M. , Ulyanov, N.B.
Date: 2006-04-05 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2GM0_A , 2GM0_B
Pcbp2 kh1-kh2 domains Deposition Author(s): Du, Z. , Fenn, S. , James, T. , Tjhen, R.
Date: 2008-01-21 Method: SOLUTION NMR Resolution: N.A. Organism(s): Salmonella Enterica Sequences Data: 2JZX_A
Structure of an engineered splicing intein mutant based on mycobacterium tuberculosis reca Deposition Author(s): Du, Z. , Wang, C.
Date: 2011-01-19 Method: SOLUTION NMR Resolution: N.A. Organism(s): Taenia Saginata Sequences Data: 2L8L_A