Structure of tar rna complexed with a tat-tar interaction nanomolar inhibitor that was identified by computational screening
PDB DOI: 10.2210/pdb1lvj/pdb
Classification: RNA Organism(s): Human Immunodeficiency Virus 1
Deposited: 2002-05-28 Deposition Author(s): Du, Z. , James, T.L. , Lind, K.E.
Method: SOLUTION NMR Resolution: N.A.
Structure of tar rna complexed with a tat-tar interaction nanomolar inhibitor that was identified by computational screening
Du, Z. , James, T.L. , Lind, K.E.
Primary Citation of Related Structures: 1LVJ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| HIV-1 Trans Activating Region RNA | a | 31 | NA | GGCCAGAUCUGAGCCUGGGAGCUCUCUGGCC |
Method: SOLUTION NMR
Deposited Date: 2002-05-28 Deposition Author(s): Du, Z. , James, T.L. , Lind, K.E.