Search Query :
1K7B
Nmr solution structure of stva47, the viral-binding domain of tva Deposition Author(s): Agard, D.A. , James, T.L. , Peters, R.J. , Tonelli, M.
Date: 2001-10-18 Method: SOLUTION NMR Resolution: N.A. Organism(s): Coturnix Coturnix Sequences Data: 1K7B_A
1KUN
Solution structure of the human alpha3-chain type vi collagen c-terminal kunitz domain, nmr, 20 structures Deposition Author(s): Bjorn, S. , James, T.L. , Led, J.J. , Norris, K. , Olsen, O. , Petersen, L. , Sorensen, M.D.
Date: 1997-03-04 Method: SOLUTION NMR Resolution: N.A. Organism(s): Homo Sapiens Sequences Data: 1KUN_A
1LVJ
Structure of tar rna complexed with a tat-tar interaction nanomolar inhibitor that was identified by computational screening Deposition Author(s): Du, Z. , James, T.L. , Lind, K.E.
Date: 2002-05-28 Method: SOLUTION NMR Resolution: N.A. Organism(s): Human Immunodeficiency Virus 1 Sequences Data: 1LVJ_A
1MFJ
3' stem-loop from human u4 snrna Deposition Author(s): Comolli, L.R. , Gmeiner, W.H. , James, T.L. , Ulyanov, N.B.
Date: 2002-08-11 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1MFJ_A
1R7W
Nmr structure of the r(ggaggacaucccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with aucccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7W_A
1R7Z
Nmr structure of the r(ggaggacauuccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with auuccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7Z_A
1ROQ
Extending the family of uncg-like tetraloop motifs: nmr structure of a cacg tetraloop from coxsackievirus b3 Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Yu, J.
Date: 2003-12-02 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1ROQ_A
1SKP
Nmr structure of d(gcatatgatag)(dot)d(ctatcatatgc): a consensus sequence for promoters recognized by sigma-k rna polymerase, 4 structures Deposition Author(s): Bianucci, A.M. , James, T.L. , Lesiak, K. , Ragg, E. , Tonelli, M.
Date: 1998-05-20 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1SKP_A , 1SKP_B
1SLS
Immobile slipped-loop structure (sls) of dna homodimer in solution, nmr, 9 structures Deposition Author(s): Ivanov, V.I. , James, T.L. , Khomyakova, E.B. , Lesiak, K. , Minyat, E.E. , Petrova, M.V. , Ulyanov, N.B.
Date: 1997-09-30 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1SLS_A , 1SLS_B
1TXS
Stem-loop d of the cloverleaf domain of enteroviral 5'utr rna Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2004-07-06 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1TXS_A