Crystal structure of the 2'-dg-iii riboswitch bound to guanine
PDB DOI: 10.2210/pdb9lkw/pdb
Classification: RNA Organism(s): Synthetic Construct
Deposited: 2025-01-16 Deposition Author(s): Ren, A.M. , Shen, X.
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (65-MER) | x | 65 | NA | GGCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAAACCACAAAUUUCUUACUGCGUC |
Method: X-RAY DIFFRACTION