9JA7
Crystal structure of theophylline aptamer obtained in the presence of caffeine
PDB DOI: 10.2210/pdb9ja7/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2024-08-24 Deposition Author(s): Kondo, J. , Ohtani, Y.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 2.59 Å
Crystal structure of theophylline aptamer obtained in the presence of caffeine
Primary Citation of Related Structures: 9JA7
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Theophylline aptamer | a | 33 | NA | GGCGAUACCAGCCGAAAGGCCCUUGGCAGCGCC |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2024-08-24 Deposition Author(s): Kondo, J. , Ohtani, Y.