9I5S
Solution structure of an intramolecular anti-parallel g-quadruplex with a 5'-end overhang.
PDB DOI: 10.2210/pdb9i5s/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2025-01-28 Deposition Author(s): Avendano Avila, C. , Heddi, B.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure of an intramolecular anti-parallel g-quadruplex with a 5'-end overhang.
Avendano Avila, C. , Heddi, B.
Primary Citation of Related Structures: 9I5S
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Human telomeric DNA G-quadruplex hteloS1[11] | a | 24 | NA | GTTAGGGTTAGGGTTAGGGTTAGG |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2025-01-28 Deposition Author(s): Avendano Avila, C. , Heddi, B.