Quadruplex-duplex hybrids (qdh) complex with phendc3 from pim1 oncogene.
PDB DOI: 10.2210/pdb9gvi/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2024-09-24 Deposition Author(s): Ghosh, A. , Harnos, J. , Lenarcic, M.Z. , Trantirek, L.
Quadruplex-duplex hybrids (qdh) complex with phendc3 from pim1 oncogene.
Ghosh, A. , Harnos, J. , Lenarcic, M.Z. , Trantirek, L.
Primary Citation of Related Structures: 9GVI
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (27-MER) complex with ligand (PhenDC3) | a | 27 | NA | GCGGGAGGGCGCGCCAGCGGGGTCGGG |
Method: SOLUTION NMR
Deposited Date: 2024-09-24 Deposition Author(s): Ghosh, A. , Harnos, J. , Lenarcic, M.Z. , Trantirek, L.