Structure of west nile virus 3'- stem-loop_68nts
PDB DOI: 10.2210/pdb9blm/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2024-04-30 Deposition Author(s): Chaubey, B. , Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Zhu, Y.
Structure of west nile virus 3'- stem-loop_68nts
Chaubey, B. , Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Zhu, Y.
Primary Citation of Related Structures: 9BLM
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (68-MER) | a | 68 | NA | GGCCUGGGAUAGACUAGGAGAUCUUCUGCUCUGCACAACCUUCGGGUGGUGCGAGAACACAGGAUACU |
Method: SOLUTION NMR
Deposited Date: 2024-04-30 Deposition Author(s): Chaubey, B. , Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Zhu, Y.