Solution structure of a lanthanide-binding dna aptamer
PDB DOI: 10.2210/pdb7qb3/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2021-11-18 Deposition Author(s): Andralojc, W. , Gdaniec, Z.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of a lanthanide-binding dna aptamer
Primary Citation of Related Structures: 7QB3
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Lanthanide-binding aptamer | a | 28 | NA | CGGCCGTCGAAGACCCGCGAAGTGGCCG |
Method: SOLUTION NMR
Deposited Date: 2021-11-18 Deposition Author(s): Andralojc, W. , Gdaniec, Z.