Complex between monomolecular human telomeric g-quadruplex and a sulfonamide derivative of the natural alkaloid berberine
PDB DOI: 10.2210/pdb7pnl/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2021-09-07 Deposition Author(s): Bazzicalupi, C. , Gratteri, P. , Nocentini, A. , Petreni, A.
Method: X-RAY DIFFRACTION Resolution: 1.83 Å
Complex between monomolecular human telomeric g-quadruplex and a sulfonamide derivative of the natural alkaloid berberine
Bazzicalupi, C. , Gratteri, P. , Nocentini, A. , Petreni, A.
Primary Citation of Related Structures: 7PNL
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
G-guadruplex DNA (23-mer) | a | 23 | NA | AGGGTTAGGGTTAGGGTTAGGGT |
Method: X-RAY DIFFRACTION
Deposited Date: 2021-09-07 Deposition Author(s): Bazzicalupi, C. , Gratteri, P. , Nocentini, A. , Petreni, A.