Parallel q-d hybrid with 3' duplex stem-loop as a lateral snapback loop
PDB DOI: 10.2210/pdb7pne/pdb
Classification: DNA Organism(s): Synthetic Construct
Deposited: 2021-09-06 Deposition Author(s): Vianney, Y.M. , Weisz, K.
Parallel q-d hybrid with 3' duplex stem-loop as a lateral snapback loop
Primary Citation of Related Structures: 7PNE
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence | 
| TTAMycdup-3sbl | a | 36 | NA | XTAGGTGGGTAGGGTGGGCTAGTCATTTTGACTAGG | 
Method: SOLUTION NMR
Deposited Date: 2021-09-06 Deposition Author(s): Vianney, Y.M. , Weisz, K.
 
                  