The structure of an i-motif/duplex junction at neutral ph
PDB DOI: 10.2210/pdb7o5e/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2021-04-08 Deposition Author(s): Escaja, N. , Gonzalez, C. , Mir, B. , Serrano-Chacon, I.
The structure of an i-motif/duplex junction at neutral ph
Escaja, N. , Gonzalez, C. , Mir, B. , Serrano-Chacon, I.
Primary Citation of Related Structures: 7O5E
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
I-motif/duplex junction (IDJ) | a | 35 | NA | CCCGTTTCCTCGCGAAGCATTCGCGCCCGTTTCCT |
Method: SOLUTION NMR
Deposited Date: 2021-04-08 Deposition Author(s): Escaja, N. , Gonzalez, C. , Mir, B. , Serrano-Chacon, I.