7KBX
Solution structure of the major myc promoter g-quadruplex in complex with nsc85697, a quinoline derivative
PDB DOI: 10.2210/pdb7kbx/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-10-03 Deposition Author(s): Dickerhoff, J. , Yang, D.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the major myc promoter g-quadruplex in complex with nsc85697, a quinoline derivative
Primary Citation of Related Structures: 7KBX
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Myc2345_T23 | a | 22 | NA | TGAGGGTGGGTAGGGTGGGTAA |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2020-10-03 Deposition Author(s): Dickerhoff, J. , Yang, D.