Solution structure of the major myc promoter g-quadruplex with a wild-type flanking sequence
PDB DOI: 10.2210/pdb7kbv/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-10-03 Deposition Author(s): Dickerhoff, J. , Yang, D.
Solution structure of the major myc promoter g-quadruplex with a wild-type flanking sequence
Primary Citation of Related Structures: 7KBV
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Myc2345 | a | 22 | NA | TGAGGGTGGGTAGGGTGGGGAA |
Method: SOLUTION NMR
Deposited Date: 2020-10-03 Deposition Author(s): Dickerhoff, J. , Yang, D.