Self-assembly of a 3d dna crystal lattice (4x6 duplex version) containing the j5 immobile holliday junction with r3 symmetry
PDB DOI: 10.2210/pdb7jrz/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-08-13 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Self-assembly of a 3d dna crystal lattice (4x6 duplex version) containing the j5 immobile holliday junction with r3 symmetry
Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Primary Citation of Related Structures: 7JRZ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*CP*GP*AP*CP*GP*GP*GP*AP*CP*TP*CP*A)-3') | b | 21 | NA | GAGCAGACCCGACGGGACTCA |
| DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*C)-3') | c | 8 | NA | TCTGAGTC |
| DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') | d | 7 | NA | GGTCTGC |
| DNA (5'-D(P*CP*CP*GP*TP*CP*G)-3') | a | 6 | NA | CCGTCG |
Method: X-RAY DIFFRACTION
Deposited Date: 2020-08-13 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.