Crystal structure of the domain1 of nad+ riboswitch with nicotinamide adenine dinucleotide (nad+)
PDB DOI: 10.2210/pdb7d7w/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2020-10-06 Deposition Author(s): Chen, H. , Ren, A.M.
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 18GAAA (52-MER) | a | 51 | NA | GCUUCAACAACCCCGUAGGUGGGGACGAAAGUCAGCGCACCUACUGGAGCC |
Method: X-RAY DIFFRACTION