Crystal structure of the l.lactis ykoy riboswitch bound to cadmium
PDB DOI: 10.2210/pdb6cb3/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2018-02-01 Deposition Author(s): Bachas, S. , Ferre-D'Amare, A.R.
Crystal structure of the l.lactis ykoy riboswitch bound to cadmium
Bachas, S. , Ferre-D'Amare, A.R.
Primary Citation of Related Structures: 6CB3
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (99-MER) | a | 101 | NA | GAAAGGGGAGUAGCGUCGGGAAACCGAAACAAAGUCGUCAAUUCGUGAGGAAACUCACCGGCUUUGUUGACAUACGAAAGUAUGUUUAGCAAGACCUUUCC |
| RNA (99-MER) | b | 101 | NA | GAAAGGGGAGUAGCGUCGGGAAACCGAAACAAAGUCGUCAAUUCGUGAGGAAACUCACCGGCUUUGUUGACAUACGAAAGUAUGUUUAGCAAGACCUUUCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2018-02-01 Deposition Author(s): Bachas, S. , Ferre-D'Amare, A.R.