2'f-ana-g modified quadruplex with a flipped tetrad
PDB DOI: 10.2210/pdb5ov2/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2017-08-27 Deposition Author(s): Dickerhoff, J. , Weisz, K.
2'f-ana-g modified quadruplex with a flipped tetrad
Primary Citation of Related Structures: 5OV2
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
artificial quadruplex with propeller, diagonal, and lateral loop | x | 22 | NA | GGGATGGGACACAGGGGACGGG |
Method: SOLUTION NMR
Deposited Date: 2017-08-27 Deposition Author(s): Dickerhoff, J. , Weisz, K.