Solution nmr structure of the gtp binding class ii rna aptamer-ligand-complex containing a protonated adenine nucleotide with a highly shifted pka.
PDB DOI: 10.2210/pdb5lwj/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2016-09-17 Deposition Author(s): Duchardt-Ferner, E. , Hantke, K. , Kreutz, C. , Nasiri, A.H. , Ohlenschlaeger, O. , Weickhmann, A.K. , Woehnert, J. , Wolter, A.C. , Wunderlich, C.H.
Solution nmr structure of the gtp binding class ii rna aptamer-ligand-complex containing a protonated adenine nucleotide with a highly shifted pka.
Duchardt-Ferner, E. , Hantke, K. , Kreutz, C. , Nasiri, A.H. , Ohlenschlaeger, O. , Weickhmann, A.K. , Woehnert, J. , Wolter, A.C. , Wunderlich, C.H.
Primary Citation of Related Structures: 5LWJ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| GTP Class II RNA (34-MER) | a | 34 | NA | GGCAGCCAGAAGAGCACGUAUACGCAAGGCUGUC |
Method: SOLUTION NMR
Deposited Date: 2016-09-17 Deposition Author(s): Duchardt-Ferner, E. , Hantke, K. , Kreutz, C. , Nasiri, A.H. , Ohlenschlaeger, O. , Weickhmann, A.K. , Woehnert, J. , Wolter, A.C. , Wunderlich, C.H.