Ground state sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat
PDB DOI: 10.2210/pdb5j0m/pdb
Classification: VIRAL PROTEIN Organism(s): Human Immunodeficiency Virus 1 , Synthetic Construct
Deposited: 2016-03-28 Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.
Method: SOLUTION NMR Resolution: N.A.
Ground state sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat
Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.
Primary Citation of Related Structures: 5J0M
Proteins | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
Cyclic peptide mimetic of HIV-1 Tat | A | 14 | Human Immunodeficiency Virus 1 , Synthetic Construct | RVRTRKGRRIRIPP |
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
Apical region (29-mer) of the HIV-1 TAR RNA element | b | 29 | NA | GGCAGAUCUGAGCCUGGGAGCUCUCUGCC |
Method: SOLUTION NMR
Deposited Date: 2016-03-28 Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.