PDBi (Protein Data Bank in India)

All in One Protein Databank
Home About Help Resources External Links Contact Us
Advanced Search
FASTA Sequence PDB Format mmCIF Format
FASTA Sequence PDB Format PDB Format(gz) PDBx/mmCIF Format PDBx/mmCIF Format(gz) PDBML/XML Format Validation Full PDF Validation CIF

5J0M

Ground state sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat

PDB DOI: 10.2210/pdb5j0m/pdb

Classification: VIRAL PROTEIN
Organism(s): Anoxybacillus Sp. Lm18-11 , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.)

Deposited: 2016-03-28
Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.

Experimental Data Snapshot

Method: SOLUTION NMR
Resolution: N.A.

5j0m
Literature

Ground state sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat

Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.

Primary Citation of Related Structures: 5J0M


Proteins
Molecule Chains Sequence Length Organism Sequence
Cyclic peptide mimetic of HIV-1 Tat A 14 Anoxybacillus Sp. Lm18-11 , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) RVRTRKGRRIRIPP

Nucleic Acids / Hybrid
Molecule Chains Sequence Length Organism Sequence
Apical region (29-mer) of the HIV-1 TAR RNA element b 29 NA GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
Experimental Data

Method: SOLUTION NMR

Deposited Date: 2016-03-28
Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.