5CCW
Structure of the complex of a human telomeric dna with au(caffein-2-ylidene)2
PDB DOI: 10.2210/pdb5ccw/pdb
Classification: DRUG/DNA Organism(s): N.A.
Deposited: 2015-07-02 Deposition Author(s): Bazzicalupi, C. , Ferraroni, M. , Gratteri, P. , Messori, L. , Papi, F.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 1.89 Å
Structure of the complex of a human telomeric dna with au(caffein-2-ylidene)2
Bazzicalupi, C. , Ferraroni, M. , Gratteri, P. , Messori, L. , Papi, F.
Primary Citation of Related Structures: 5CCW
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human telomeric DNA | a | 23 | NA | TAGGGTTAGGGTTAGGGTTAGGG |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2015-07-02 Deposition Author(s): Bazzicalupi, C. , Ferraroni, M. , Gratteri, P. , Messori, L. , Papi, F.