Crystal structure of the bacterial a1408c-mutant ribosomal decoding site in complex with geneticin
PDB DOI: 10.2210/pdb4p3s/pdb
Classification: RNA/ANTIBIOTIC Organism(s): N.A.
Deposited: 2014-03-10 Deposition Author(s): Koganei, M. , Kondo, J.
Crystal structure of the bacterial a1408c-mutant ribosomal decoding site in complex with geneticin
Primary Citation of Related Structures: 4P3S
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 5'-R(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU)P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' | a | 23 | NA | UUGCGUCCCGUCGACGAAGUCGC |
| 5'-R(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU)P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' | b | 23 | NA | UUGCGUCCCGUCGACGAAGUCGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2014-03-10 Deposition Author(s): Koganei, M. , Kondo, J.