4FEO
Crystal structure of the au25a/a46g/c74u mutant xpt-pbux guanine riboswitch aptamer domain in complex with 2,6-diaminopurine
PDB DOI: 10.2210/pdb4feo/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2012-05-30 Deposition Author(s): Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 1.6 Å
Crystal structure of the au25a/a46g/c74u mutant xpt-pbux guanine riboswitch aptamer domain in complex with 2,6-diaminopurine
Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.
Primary Citation of Related Structures: 4FEO
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| U25A/A46G/C74U mutant of the B. subtilis xpt-pbuX guanine riboswitch aptamer domain | b | 67 | NA | GGACAUAUAAACGCGUGGAUAUGGCACGCGAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUCC |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2012-05-30 Deposition Author(s): Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.