The structure of the tetrahydrofolate riboswitch containing a u25c mutation
PDB DOI: 10.2210/pdb3sd3/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2011-06-08 Deposition Author(s): Batey, R.T. , Ceres, P. , Reyes, F.E. , Trausch, J.J.
The structure of the tetrahydrofolate riboswitch containing a u25c mutation
Batey, R.T. , Ceres, P. , Reyes, F.E. , Trausch, J.J.
Primary Citation of Related Structures: 3SD3
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Tetrahydrofolate riboswitch | a | 89 | NA | GGAGAGUAGAUGAUUCGCGUUAAGCGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCAUCCGCUCCA |
Method: X-RAY DIFFRACTION
Deposited Date: 2011-06-08 Deposition Author(s): Batey, R.T. , Ceres, P. , Reyes, F.E. , Trausch, J.J.