3BNQ
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of srcl2 (a1555g mutant, br-derivative)
PDB DOI: 10.2210/pdb3bnq/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 2 Å
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of srcl2 (a1555g mutant, br-derivative)
Primary Citation of Related Structures: 3BNQ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| A site of human mitochondrial ribosome, A chain | a | 23 | NA | UUGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, A chain | b | 23 | NA | UUGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, A chain | c | 23 | NA | UUGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, B chain | d | 21 | NA | GCGUCACCUCGAGCAAGUCGC |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.