3BNO
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site (br-derivative)
PDB DOI: 10.2210/pdb3bno/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 2.35 Å
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site (br-derivative)
Primary Citation of Related Structures: 3BNO
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| A site of human mitochondrial ribosome | a | 21 | NA | GCGUCACCUCGAACAAGUCGC |
| A site of human mitochondrial ribosome | b | 21 | NA | GCGUCACCUCGAACAAGUCGC |
| A site of human mitochondrial ribosome | c | 21 | NA | GCGUCACCUCGAACAAGUCGC |
| A site of human mitochondrial ribosome | d | 21 | NA | GCGUCACCUCGAACAAGUCGC |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.