Solution structure of domain ii of the positive polarity cchmvd hammerhead ribozyme
PDB DOI: 10.2210/pdb2rpk/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2008-05-28 Deposition Author(s): De La Pena, M. , Dufour, D. , Flores, R. , Gago, S. , Gallego, J.
Solution structure of domain ii of the positive polarity cchmvd hammerhead ribozyme
De La Pena, M. , Dufour, D. , Flores, R. , Gago, S. , Gallego, J.
Primary Citation of Related Structures: 2RPK
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') | a | 20 | NA | GGGAUCCAUGACAGGAUCCC |
Method: SOLUTION NMR
Deposited Date: 2008-05-28 Deposition Author(s): De La Pena, M. , Dufour, D. , Flores, R. , Gago, S. , Gallego, J.