2QH2
Solution structure of the cr7 terminal hairpin loop from human telomerase rna
PDB DOI: 10.2210/pdb2qh2/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-06-29 Deposition Author(s): Breece, K.E. , Chim, N. , Feigon, J. , Theimer, C.A.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the cr7 terminal hairpin loop from human telomerase rna
Breece, K.E. , Chim, N. , Feigon, J. , Theimer, C.A.
Primary Citation of Related Structures: 2QH2
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Human telomerase RNA CR7 terminal hairpin loop | a | 24 | NA | GGAGUGCCUGAGCUGUGGCACUCC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2007-06-29 Deposition Author(s): Breece, K.E. , Chim, N. , Feigon, J. , Theimer, C.A.