Solution structure of the k domain of emcv ires
PDB DOI: 10.2210/pdb2nbz/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2016-03-16 Deposition Author(s): D'Souza, V. , Imai, S. , Wagner, G.
Solution structure of the k domain of emcv ires
D'Souza, V. , Imai, S. , Wagner, G.
Primary Citation of Related Structures: 2NBZ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| IRES RNA 40-MER | a | 40 | NA | GGGCUCGGUGCACAUGCUUUACAUGUGUUUAGUCGAGCCC |
Method: SOLUTION NMR
Deposited Date: 2016-03-16 Deposition Author(s): D'Souza, V. , Imai, S. , Wagner, G.