Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution)
PDB DOI: 10.2210/pdb2kf7/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2009-02-12 Deposition Author(s): Amrane, S. , Bouaziz, S. , Lim, K.W. , Luu, K.N. , Mu, Y. , Patel, D.J. , Phan, A.T. , Xu, W.
Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution)
Amrane, S. , Bouaziz, S. , Lim, K.W. , Luu, K.N. , Mu, Y. , Patel, D.J. , Phan, A.T. , Xu, W.
Primary Citation of Related Structures: 2KF7
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| HUMAN TELOMERE DNA | a | 22 | NA | GGGTTAGGGTTAGGGTTAGGGT |
Method: SOLUTION NMR
Deposited Date: 2009-02-12 Deposition Author(s): Amrane, S. , Bouaziz, S. , Lim, K.W. , Luu, K.N. , Mu, Y. , Patel, D.J. , Phan, A.T. , Xu, W.