Solution structure and dynamics of the apical stem-loop of duck hepatitis b virus
PDB DOI: 10.2210/pdb2k5z/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2008-07-01 Deposition Author(s): Ampt, K.A.M. , Tessari, M. , Wijmenga, S.S.
Method: SOLUTION NMR Resolution: N.A.
Solution structure and dynamics of the apical stem-loop of duck hepatitis b virus
Ampt, K.A.M. , Tessari, M. , Wijmenga, S.S.
Primary Citation of Related Structures: 2K5Z
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Duck HBV apical loop | a | 29 | NA | GGUCUACAUUGCUGUUGUCGUGUGUGACC |
Method: SOLUTION NMR
Deposited Date: 2008-07-01 Deposition Author(s): Ampt, K.A.M. , Tessari, M. , Wijmenga, S.S.