Monomeric human telomere dna tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, nmr, 12 structures
PDB DOI: 10.2210/pdb2gku/pdb
Classification: DNA Organism(s): Salmonella Enterica
Deposited: 2006-04-03 Deposition Author(s): Kuryavyi, V.V. , Lacroix, L. , Luu, K.N. , Patel, D.J. , Phan, A.T.
Method: SOLUTION NMR Resolution: N.A.
Monomeric human telomere dna tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, nmr, 12 structures
Kuryavyi, V.V. , Lacroix, L. , Luu, K.N. , Patel, D.J. , Phan, A.T.
Primary Citation of Related Structures: 2GKU
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
Human telomere DNA | a | 24 | NA | TTGGGTTAGGGTTAGGGTTAGGGA |
Method: SOLUTION NMR
Deposited Date: 2006-04-03 Deposition Author(s): Kuryavyi, V.V. , Lacroix, L. , Luu, K.N. , Patel, D.J. , Phan, A.T.