The structure of stem loop iv of tetrahymena telomerase rna
PDB DOI: 10.2210/pdb2fey/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2005-12-16 Deposition Author(s): Bryan, T.M. , Chen, Y. , Fender, J. , Jarstfer, M.B. , Legassie, J.D. , Varani, G.
The structure of stem loop iv of tetrahymena telomerase rna
Bryan, T.M. , Chen, Y. , Fender, J. , Jarstfer, M.B. , Legassie, J.D. , Varani, G.
Primary Citation of Related Structures: 2FEY
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| stem-loop IV of Tetrahymena telomerase RNA | a | 43 | NA | GAGACUAUCGACAUUUGAUACACUAUUUAUCAAUGGAUGUCUC |
Method: SOLUTION NMR
Deposited Date: 2005-12-16 Deposition Author(s): Bryan, T.M. , Chen, Y. , Fender, J. , Jarstfer, M.B. , Legassie, J.D. , Varani, G.