The structure of an enzyme-activating fragment of human telomerase rna
PDB DOI: 10.2210/pdb1z31/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2005-03-10 Deposition Author(s): Leeper, T.C. , Varani, G.
The structure of an enzyme-activating fragment of human telomerase rna
Primary Citation of Related Structures: 1Z31
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human telomerase PJ6 hairpin | a | 32 | NA | GAGGUCGGCCCGACUUCGGUCACUGCCACCUC |
Method: SOLUTION NMR
Deposited Date: 2005-03-10 Deposition Author(s): Leeper, T.C. , Varani, G.