Crystal structure of the specificity domain of ribonuclease p of the a-type
PDB DOI: 10.2210/pdb1u9s/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2004-08-10 Deposition Author(s): Krasilnikov, A.S. , Mondragon, A. , Pan, T. , Xiao, Y.
Crystal structure of the specificity domain of ribonuclease p of the a-type
Krasilnikov, A.S. , Mondragon, A. , Pan, T. , Xiao, Y.
Primary Citation of Related Structures: 1U9S
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RIBONUCLEASE P | a | 161 | NA | GGGUGCCAGGUAACGCCUGGGCGGGGUAACCCGACGGAAAGUGCCACAGAGAAGAGACCGCCAGCGGCCGGGGCUUCCCCCGGUGCGGGCAAGGGUGAAACGGCGGGGUAAGAGCCCACCGCCUGGCCUGGCAACAGGCCGGGGCACGGCAAACCCCACCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2004-08-10 Deposition Author(s): Krasilnikov, A.S. , Mondragon, A. , Pan, T. , Xiao, Y.