Refined solution structure of the s. cerevisiae u6 intramolecular stem loop (isl) rna using residual dipolar couplings (rdcs)
PDB DOI: 10.2210/pdb1sy4/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2004-03-31 Deposition Author(s): Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.
Method: SOLUTION NMR Resolution: N.A.
Refined solution structure of the s. cerevisiae u6 intramolecular stem loop (isl) rna using residual dipolar couplings (rdcs)
Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.
Primary Citation of Related Structures: 1SY4
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
U6 Intramolecular Stem-Loop RNA | a | 24 | NA | GGUUCCCCUGCAUAAGGAUGAACC |
Method: SOLUTION NMR
Deposited Date: 2004-03-31 Deposition Author(s): Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.