Nmr structure of the 30mer stemloop-d of coxsackieviral rna
PDB DOI: 10.2210/pdb1rfr/pdb
Classification: RNA Organism(s): Human Coxsackievirus B3
Deposited: 2003-11-10 Deposition Author(s): Bucci, E. , Gorlach, M. , Hafner, S. , Ohlenschlager, O. , Ramachandran, R. , Seitz, S. , Wohnert, J. , Zell, R.
Nmr structure of the 30mer stemloop-d of coxsackieviral rna
Bucci, E. , Gorlach, M. , Hafner, S. , Ohlenschlager, O. , Ramachandran, R. , Seitz, S. , Wohnert, J. , Zell, R.
Primary Citation of Related Structures: 1RFR
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| stemloop-D RNA of the 5'-cloverleaf of coxsackievirus B3 | a | 30 | NA | GGCACUCUGGUAUCACGGUACCUUUGUGUC |
Method: SOLUTION NMR
Deposited Date: 2003-11-10 Deposition Author(s): Bucci, E. , Gorlach, M. , Hafner, S. , Ohlenschlager, O. , Ramachandran, R. , Seitz, S. , Wohnert, J. , Zell, R.