Solution structure of the s. cerevisiae u6 intramolecular stem-loop containing an sp phosphorothioate at nucleotide u80
PDB DOI: 10.2210/pdb1nz1/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2003-02-14 Deposition Author(s): Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the s. cerevisiae u6 intramolecular stem-loop containing an sp phosphorothioate at nucleotide u80
Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.
Primary Citation of Related Structures: 1NZ1
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| SP U6 Intramolecular Stem-Loop RNA | a | 24 | NA | GGUUCCCCUGCAUAAGGAUGAACC |
Method: SOLUTION NMR
Deposited Date: 2003-02-14 Deposition Author(s): Allman, A.M. , Butcher, S.E. , Johnson, R.J. , Nikstad, L.J. , Reiter, N.J.