Solution structure of influenza a virus c4 promoter
PDB DOI: 10.2210/pdb1mfy/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-08-14 Deposition Author(s): Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Lee, M.-K. , Park, C.-J.
Solution structure of influenza a virus c4 promoter
Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Lee, M.-K. , Park, C.-J.
Primary Citation of Related Structures: 1MFY
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| C4 promoter of influneza A virus | a | 31 | NA | AGUAGAAACAAGGCUUCGGCCUGCUUUCGCU |
Method: SOLUTION NMR
Deposited Date: 2002-08-14 Deposition Author(s): Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Lee, M.-K. , Park, C.-J.