Structure of wild-type and mutant internal loops from the sl-1 domain of the hiv-1 packaging signal
PDB DOI: 10.2210/pdb1m5l/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-07-09 Deposition Author(s): Gallego, J. , Greatorex, J. , Lever, A. , Varani, G.
Structure of wild-type and mutant internal loops from the sl-1 domain of the hiv-1 packaging signal
Gallego, J. , Greatorex, J. , Lever, A. , Varani, G.
Primary Citation of Related Structures: 1M5L
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
modified HIV-1 packaging signal stem-loop 1 RNA | a | 38 | NA | GCGCAGGACUCGGCUUCUUCGGAAGGGACGAGGGGCGC |
Method: SOLUTION NMR
Deposited Date: 2002-07-09 Deposition Author(s): Gallego, J. , Greatorex, J. , Lever, A. , Varani, G.