1LC6
Solution structure of the u6 intramolecular stem-loop rna
PDB DOI: 10.2210/pdb1lc6/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-04-05 Deposition Author(s): Allmann, A.M. , Brow, D.A. , Butcher, S.E. , Huppler, A. , Nikstad, L.J.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the u6 intramolecular stem-loop rna
Allmann, A.M. , Brow, D.A. , Butcher, S.E. , Huppler, A. , Nikstad, L.J.
Primary Citation of Related Structures: 1LC6
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| U6 Intramolecular Stem-loop RNA | a | 24 | NA | GGUUCCCCUGCAUAAGGAUGAACC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2002-04-05 Deposition Author(s): Allmann, A.M. , Brow, D.A. , Butcher, S.E. , Huppler, A. , Nikstad, L.J.