Nmr structure of an at-rich dna with the gaa-hairpin loop
PDB DOI: 10.2210/pdb1jve/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2001-08-29 Deposition Author(s): Bauer, W.R. , James, T.L. , Ulyanov, N.B.
Nmr structure of an at-rich dna with the gaa-hairpin loop
Bauer, W.R. , James, T.L. , Ulyanov, N.B.
Primary Citation of Related Structures: 1JVE
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
AT-Rich DNA with the GAA-Hairpin Loop | a | 27 | NA | CCTAATTATAACGAAGTTATAATTAGG |
Method: SOLUTION NMR
Deposited Date: 2001-08-29 Deposition Author(s): Bauer, W.R. , James, T.L. , Ulyanov, N.B.