Nmr structure of the lp5.1 hairpin from bacillus rnase p rna refined without residual dipolar couplings
PDB DOI: 10.2210/pdb1jp0/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2001-07-31 Deposition Author(s): Leeper, T.C. , Schmidt, F.J. , Van Doren, S.R.
Nmr structure of the lp5.1 hairpin from bacillus rnase p rna refined without residual dipolar couplings
Leeper, T.C. , Schmidt, F.J. , Van Doren, S.R.
Primary Citation of Related Structures: 1JP0
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*GP*AP*UP*GP*CP*CP*CP*GP*UP*C)-3' | a | 21 | NA | GGCGGUGCUGAGAUGCCCGUC |
Method: SOLUTION NMR
Deposited Date: 2001-07-31 Deposition Author(s): Leeper, T.C. , Schmidt, F.J. , Van Doren, S.R.