Search Query :
1E26
Design, synthesis and x-ray crystal structure of a potent dual inhibitor of thymidylate synthase and dihydrofolate reductase as an antitumor agent. Deposition Author(s): Cody, V. , Galitsky, N. , Gangjee, A. , Kisliuk, R.L. , Mcguire, J.J. , Queener, S.F. , Yu, J.
Date: 2000-05-17 Method: X-RAY DIFFRACTION Resolution: 2 Å Organism(s): Pneumocystis Carinii Sequences Data: 1E26_A
1R7W
Nmr structure of the r(ggaggacaucccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with aucccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7W_A
1R7Z
Nmr structure of the r(ggaggacauuccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with auuccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7Z_A
1ROQ
Extending the family of uncg-like tetraloop motifs: nmr structure of a cacg tetraloop from coxsackievirus b3 Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Yu, J.
Date: 2003-12-02 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1ROQ_A
1TXS
Stem-loop d of the cloverleaf domain of enteroviral 5'utr rna Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2004-07-06 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1TXS_A
2HQM
Crystal structure of glutathione reductase glr1 from the yeast saccharomyces cerevisiae Deposition Author(s): Yu, J. , Zhou, C.Z.
Date: 2006-07-19 Method: X-RAY DIFFRACTION Resolution: 2.4 Å Organism(s): Saccharomyces Cerevisiae Sequences Data: 2HQM_A , 2HQM_B
2KSM
Central b domain of rv0899 from mycobacterium tuberculosis Deposition Author(s): Kolodzik, A. , Marassi, F.M. , Niederweis, M. , Song, H. , Teriete, P. , Yao, Y. , Yu, J.
Date: 2010-01-07 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mycobacterium Tuberculosis Sequences Data: 2KSM_A
2M80
Solution structure of yeast dithiol glutaredoxin grx8 Deposition Author(s): Shi, Y. , Tang, Y. , Wu, J. , Yu, J. , Zhang, J. , Zhou, C.Z.
Date: 2013-05-02 Method: SOLUTION NMR Resolution: N.A. Organism(s): Saccharomyces Cerevisiae Sequences Data: 2M80_A
2OWL
Crystal structure of e. coli rdgc Deposition Author(s): Briggs, G.S. , Emsley, J. , Lloyd, R.G. , Mcewan, P.A. , Moore, T. , Yu, J.
Date: 2007-02-16 Method: X-RAY DIFFRACTION Resolution: 2.4 Å Organism(s): Escherichia Coli Sequences Data: 2OWL_A , 2OWL_B
2QJL
Crystal structure of urm1 Deposition Author(s): Yu, J. , Zhou, C.Z.
Date: 2007-07-07 Method: X-RAY DIFFRACTION Resolution: 1.44 Å Organism(s): Saccharomyces Cerevisiae Sequences Data: 2QJL_A