Solution nmr structure of recombinant syrian hamster prion protein rprp(90-231) , 25 structures Deposition Author(s): Farr-Jones, S. , James, T.L. , Liu, H. , Ulyanov, N.B.
Date: 1998-11-25 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mesocricetus Auratus Sequences Data: 1B10_A
Nmr structure of an at-rich dna with the gaa-hairpin loop Deposition Author(s): Bauer, W.R. , James, T.L. , Ulyanov, N.B.
Date: 2001-08-29 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1JVE_A
3' stem-loop from human u4 snrna Deposition Author(s): Comolli, L.R. , Gmeiner, W.H. , James, T.L. , Ulyanov, N.B.
Date: 2002-08-11 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1MFJ_A
Nmr structure of the r(ggaggacaucccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with aucccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7W_A
Nmr structure of the r(ggaggacauuccucacgggugaccgugguccucc), domain iv stem-loop b of enteroviral ires with auuccu bulge Deposition Author(s): Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2003-10-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R7Z_A
Immobile slipped-loop structure (sls) of dna homodimer in solution, nmr, 9 structures Deposition Author(s): Ivanov, V.I. , James, T.L. , Khomyakova, E.B. , Lesiak, K. , Minyat, E.E. , Petrova, M.V. , Ulyanov, N.B.
Date: 1997-09-30 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1SLS_A , 1SLS_B
Stem-loop d of the cloverleaf domain of enteroviral 5'utr rna Deposition Author(s): Andino, R. , Du, Z. , James, T.L. , Ulyanov, N.B. , Yu, J.
Date: 2004-07-06 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1TXS_A
Linear dimer of stemloop sl1 from hiv-1 Deposition Author(s): Du, Z. , James, T.L. , Mujeeb, A. , Parslow, T.G. , Tonelli, M. , Ulyanov, N.B.
Date: 2006-04-05 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2GM0_A , 2GM0_B
A pyrimidine motif triple helix in the kluyveromyces lactis telomerase rna pseudoknot is essential for function in vivo Deposition Author(s): Brown, Y. , Cash, D.D. , Cohen, O. , Feigon, J. , Kim, N. , Shefer, K. , Tzfati, Y. , Ulyanov, N.B.
Date: 2013-05-22 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2M8K_A