Solution structure of the p2b hairpin from human telomerase rna Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A. , Trantirek, L.
Date: 2002-11-26 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1NA2_A
Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12. Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWA_A
Nmr structure of 5'-r(ggacacgaaaucccgaaguagugucc)-3' : an rna hairpin containing the in vitro selected consensus sequence for nucleolin rbd12 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWB_A
Solution structure of the complex formed by the two n-terminal rna-binding domains of nucleolin and a pre-rrna target Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Kim, S. , Laird-Offringa, I.A. , Mueller, T.D. , Trantirek, L.
Date: 2003-11-21 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mesocricetus Auratus , Synthetic Construct Sequences Data: 1RKJ_B , 1RKJ_A
Crystal structures of trypanosoma bruciei mrp1/mrp2 Deposition Author(s): Karamooz, E. , Lukes, J. , Schumacher, M.A. , Trantirek, L. , Zikova, A.
Date: 2006-03-28 Method: X-RAY DIFFRACTION Resolution: 1.89 Å Organism(s): Trypanosoma Brucei Sequences Data: 2GIA_A , 2GIA_G , 2GIA_B , 2GIA_D
Crystal structures of trypanosoma bruciei mrp1/mrp2 Deposition Author(s): Karamooz, E. , Lukes, J. , Schumacher, M.A. , Trantirek, L. , Zikova, A.
Date: 2006-03-28 Method: X-RAY DIFFRACTION Resolution: 3.35 Å Organism(s): Trypanosoma Brucei Sequences Data: 2GID_A , 2GID_G , 2GID_H , 2GID_P , 2GID_B , 2GID_D , 2GID_K , 2GID_J
Structure of a guiderna-binding protein complex bound to a grna Deposition Author(s): Karamooz, E. , Lukes, J. , Schumacher, M.A. , Trantirek, L. , Zikova, A.
Date: 2006-03-30 Method: X-RAY DIFFRACTION Resolution: 3.37 Å Organism(s): Trypanosoma Brucei , Synthetic Construct Sequences Data: 2GJE_R , 2GJE_S , 2GJE_A , 2GJE_D
Solution structure of the tetrahymena telomerase rna stem iv terminal loop Deposition Author(s): Cash, D.D. , Collins, K. , Feigon, J. , O'Connor, C.M. , Richards, R.J. , Trantirek, L. , Wu, H.
Date: 2012-12-11 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2M21_A
Structure of a stable g-hairpin Deposition Author(s): Amato, J. , Fiala, R. , Gajarsky, M. , Pagano, B. , Plavec, J. , Sponer, J. , Stadlbauer, P. , Tomaska, L. , Trantirek, L. , Zivkovic, M.L.
Date: 2016-10-11 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 5M1W_A
Sc14 g-hairpin Deposition Author(s): Lenarcic Zivkovic, M. , Plavec, J. , Trantirek, L.
Date: 2019-04-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 6R8E_A