Search Query :
9YZA
Isoreticular co-crystal 1 of protein variant replication initiator protein repe54 (l53g, q54g, e55g) with symmetrical expanded duplex (31mer) containing insert sequence cccggccgga Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.05 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZA_A , 9YZA_B , 9YZA_C
9YZB
Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence acggtaatta Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 4.13 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZB_A , 9YZB_B , 9YZB_C
9YZC
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence cgcgcgcgcg Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.16 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZC_A , 9YZC_B , 9YZC_C
9YZD
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ctaattaggc Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.09 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZD_A , 9YZD_B , 9YZD_C
9YZE
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 4.07 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZE_A , 9YZE_B , 9YZE_C
9YZF
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence aattaggccg Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.07 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZF_A , 9YZF_B , 9YZF_C
9YZG
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence atgagtcata Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.09 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZG_A , 9YZG_B , 9YZG_C
9YZI
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence cccggccgga Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 4 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZI_A , 9YZI_B , 9YZI_C
9YZJ
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence cgtaattagg Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 2.97 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZJ_A , 9YZJ_B , 9YZJ_C
9YZK
Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence acccttctatgacctactcca Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 5.1 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZK_C , 9YZK_E , 9YZK_F