The solution structures of mutant calbindin d9k's, as determined by nmr, show that the calcium binding site can adopt different folds Deposition Author(s): Drakenberg, T. , Johansson, C. , Ullner, M.
Date: 1993-04-23 Method: SOLUTION NMR Resolution: N.A. Organism(s): Bos Taurus Sequences Data: 1BOC_A
The solution structures of mutant calbindin d9k's, as determined by nmr, show that the calcium binding site can adopt different folds Deposition Author(s): Drakenberg, T. , Johansson, C. , Ullner, M.
Date: 1993-04-23 Method: SOLUTION NMR Resolution: N.A. Organism(s): Bos Taurus Sequences Data: 1BOD_A
Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12. Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWA_A
Nmr structure of 5'-r(ggacacgaaaucccgaaguagugucc)-3' : an rna hairpin containing the in vitro selected consensus sequence for nucleolin rbd12 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWB_A
Solution structure of the complex formed by the two n-terminal rna-binding domains of nucleolin and a pre-rrna target Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Kim, S. , Laird-Offringa, I.A. , Mueller, T.D. , Trantirek, L.
Date: 2003-11-21 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mesocricetus Auratus , Synthetic Construct Sequences Data: 1RKJ_B , 1RKJ_A
Structural characterization of nop10p using nuclear magnetic resonance spectroscopy Deposition Author(s): Caizergues-Ferrer, M. , Feigon, J. , Johansson, C. , Khanna, M. , Wu, H.
Date: 2004-11-23 Method: SOLUTION NMR Resolution: N.A. Organism(s): Saccharomyces Cerevisiae Sequences Data: 1Y2Y_A
Crystal structure of human nadp-dependent leukotriene b4 12-hydroxydehydrogenase Deposition Author(s): Arrowsmith, C. , Edwards, A. , Guo, K. , Johansson, C. , Oppermann, U. , Savitsky, P. , Structural Genomics Consortium (Sgc) , Sundstrom, M. , Turnbull, A.P. , Von Delft, F.
Date: 2005-05-25 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Homo Sapiens Sequences Data: 1ZSV_A , 1ZSV_B , 1ZSV_C , 1ZSV_D
The structure of human mitochondrial 2-enoyl thioester reductase (cgi-63) Deposition Author(s): Arrowsmith, C. , Edwards, A. , Johansson, C. , Kavanagh, K.L. , Lukacik, P. , Oppermann, U. , Shafqat, N. , Smee, C. , Structural Genomics Consortium (Sgc) , Sundstrom, M. , Von Delft, F.
Date: 2005-05-25 Method: X-RAY DIFFRACTION Resolution: 1.75 Å Organism(s): Homo Sapiens Sequences Data: 1ZSY_A
Structure of the regulator of g-protein signaling domain of rgs7 Deposition Author(s): Arrowsmith, C. , Debreczeni, J. , Doyle, D.A. , Edwards, A. , Elkins, J.M. , Gileadi, O. , Johansson, C. , Phillips, C. , Schoch, G.A. , Smee, C. , Structural Genomics Consortium (Sgc) , Sundstrom, M. , Von Delft, F.
Date: 2005-07-04 Method: X-RAY DIFFRACTION Resolution: 2 Å Organism(s): Homo Sapiens Sequences Data: 2A72_A , 2A72_B
Structure of aminoadipate-semialdehyde dehydrogenase- phosphopantetheinyl transferase Deposition Author(s): Arrowsmith, C. , Bunkoczi, G. , Dubinina, E. , Edwards, A. , Johansson, C. , Oppermann, U. , Smee, C. , Sundstrom, M. , Turnbull, A. , Von Delft, F. , Weigelt, J. , Wu, X.
Date: 2005-07-29 Method: X-RAY DIFFRACTION Resolution: 2 Å Organism(s): Homo Sapiens Sequences Data: 2BYD_A