Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.716 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHV_A , 4IHV_B , 4IHV_C , 4IHV_D
Crystal structure of fis bound to 27 bp inosine substituted dna f28-di (aaatttgtttgaicittgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.7 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHW_A , 4IHW_B , 4IHW_C , 4IHW_D
Crystal structure of fis bound to 27 bp 2-aminopurine substituted dna f28-2ap (aaatttgtttga2t2ttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.8 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHX_A , 4IHX_B , 4IHX_C , 4IHX_D
Crystal structure of fis bound to 27bp inosine substituted dna f29-di (aaatttgtttgiicictgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.9 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHY_A , 4IHY_B , 4IHY_C , 4IHY_D
Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.561 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS9_A , 5DS9_B , 5DS9_C , 5DS9_D
Crystal structure of fis bound to 27bp dna f1-8c (aaattcgtttgaattttgagcgaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.642 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5DTD_A , 5DTD_B , 5DTD_C , 5DTD_D
Crystal structure of fis bound to 27bp dna f1-8g (aaattggtttgaattttgagccaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3L_A , 5E3L_B , 5E3L_C , 5E3L_D
Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C. , Stella, S.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.886 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3M_A , 5E3M_B , 5E3M_C , 5E3M_D
Crystal structure of fis bound to 27bp dna f31 (aaatttgtaggaattttctgcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3N_A , 5E3N_B , 5E3N_C , 5E3N_D
Crystal structure of fis bound to 27bp dna f32 (aaatttggaggaattttctccaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.78 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3O_A , 5E3O_B , 5E3O_C , 5E3O_D